Phenylalanine hydroxylase (PAH) Gene Essay Example

Phenylalanine hydroxylase (PAH) Gene Paper Phenylalanine hydroxylase (PAH) Gene Background: We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you FOR ONLY $16.38 $13.9/page Hire Writer Phenylalanine hydroxylase (PAH) encodes the liver-secreted enzyme of the same name, a catalyst for the hydroxylation of tyrosine from phenylalanine, a rate-limiting step in the catabolism of the latter. This reaction only occurs in the presence of the cofactor tetrahydrobiopterin (BH4) as well as molecular oxygen and iron (1). Mutations in the PAH gene are generally caused by a change of an amino acid, for example, the change of arginine to tryptophan (2, 3). The numerous possible mutations in this gene result in a lack of enzyme activity. Thus, because of its main function, the deficiency in the activity of PAH causes a marked intolerance of the consumption of phenylalanine, an essential amino acid. This causes phenylketonuria (PKU), non-phenylketonuria hyperphenylalaninemia (non-PKU HPA), mild hyperphenylalaninemia (MHP), and other variant PKU (4, 5, 6). Defects in the PAH gene leads to the deficiency or the disruption of the production of the PAH enzyme; this is most commonly related to the resulting disorder, phenylketonuria. PKU is an autosomal, inborn, recessive disorder of phenylalanine metabolism (7). There are three common types of PKU. First, there is classical PKU, caused by the mutation of both alleles of the PAH gene in chromosome 12 which results in a severe deficiency or complete absence of the PAH enzyme, leading to toxic levels of unhydroxylated phenylalanine, typically over 10 times higher than normal concentrations (i.e. over 1000  µmol compared to the normal 100  µmol). Next, there is MHP, the mildest form of the PAH enzyme deficiency, with phenylalanine levels below 600  µmol but above normal. Thirdly, there is non-PKU HPA, caused by mutations in the PAH locus that hinder BH4 synthesis and regeneration. This relatively milder form of the disorder often results in heterozygous cases through a combination of mi ld and severe mutations (4, 7, 8). Severe classical PKU, if left untreated, is commonly known to result in the impedance of postnatal cognitive development causing mental retardation and in metabolic abnormalities causing increased phenylalanine in in the blood circulation and phenylpyruvic acid in the urine. PKU has also been known to cause skin abnormalities, organ damage, different kinds of posture peculiarities, pregnancy problems (maternal PKU), an odor describe as â€Å"mousy†, as well as other mental issues such as epilepsy, hyperactivity, and psychotic episodes (1,4,7,8). The most common negative effect associated with PKU, mental retardation, is caused by a neurotoxic effect of HPA. And while PKU is an inherited disorder, its negative effects could also be induced in the offspring of mothers with PKU, resulting not only in high fetus mortality rates but also in a high probability that the children are born with growth and mental retardations as well as malformations. This is known as PKU embryofetopath y or maternal PKU syndrome (8). Conversely, children born with non-PKU HPA and MHP have marked lower risks of being affect with the adverse effects of the disorder and can have normal development mentally and physically even with the absence of treatment (4,8). Despite the severe potential effects of classical PKU, newborn screening for high levels of phenylalanine has helped early diagnosis of the disorder, which is then followed by rapid treatment. Dietary restrictions of phenylalanine has been used for early treatment of PKU which, while not necessarily lead to complete normalization of IQ, was shown to be predictive of overall IQ with the complete lack of treatment in classical PKU patients leading to severe and irreversible cognitive retardation.(1,8) Thus, primary screening of neonates and children as well as awareness of the disorder for the parents are essential (3, 6). Results and Discussion: PAH chromosomal map position and nearby genes: The location of the PAH gene is at chromosome 12. Its long arm (q) is comprised of 13 exons with an approximate length of 90 kb. Figure 1 Chromosome 12 (9) Figure 1, above, is a representation of the entire chromosome 12 with both its short arm (p) and long arm (q) as it appears in the Ensembl website, albeit cropped to fit the page. This figure can be found by searching for the PAH gene and clicking on the â€Å"Location† link on the PAH listing. The website lists the location of the gene to be at â€Å"Chromosome 12: 103,232,104-103,311,381 reverse strand.†(2) Though the website does not explicitly state where in chromosome 12 PAH is located, one can infer additional details from the provided images. For example, confusion can ensue from the fact that the indicated location in the image in the Ensembl website is on the long arm on q23.2, while previous sources have stated that it is located on q22-24.2. However, from the code in the location and the additional images, one can infer that these are the transcribed portions of the gene, two of which are illustrated in the site. Furthermore, one can see that the PAH gene is flanked by the genes insulin-like growth factor 1 (IGF1), or somatomedin C, and achaete-scute complex homolog 1 (ASCL1). To obtain the information, though, one needs to explore the interactive image (see Figure 2 below) and go to the individual pages of the neighbor genes. Figure 2 Detailed view of region near PAH (9) The NCBI website, however, while very extensive in details, and containing multiple transcripts pertaining to the PAH gene, can be somewhat confusing with regard to the Map Viewer. Going through the home page and directly searching for the desired gene results in a very large and confusing map, with the details of the gene and its neighboring gene beyond the page to right. For a beginner who is not quite sure what to look for, the NCBI Map Viewer can be very overwhelming. Focusing on the table and not the map, however, one can see that the PAH gene is located in Chromosome 12, in the long arm q22-q24.2; this information is under the heading â€Å"Cyto† (for cytogenic) and stated as â€Å"12q22-q24.2† (10). Again, this might not be immediately clear to a beginner. Furthermore, the different master map options (Morbid, Gene_cyto, etc.) individually show different arrangements of the symbols, not all of which seem to be genes. Thus, it is very hard to decipher which genes are actually near PAH, although zooming in on the â€Å"Genes on Sequence† and â€Å"Phenotype† maps do reveal the proximity of IGF1 and ASCL1. In all, for a beginner, the Ensembl website proved to be much easier to use to answer the first question. The intron/exon structure of the PAH gene: It was very difficult to find an illustration of the structure of the PAH gene in the NCBI website. However, the information page for the gene stated that the gene spans 90 kb with the entire sequence and its adjacent regions a total of 171 kb. Furthermore, it states that the gene contains 13 exons, which consequently means that it has 12 introns (number of introns is one less than the number of exons) (1). After some searching, however, beginning with clicking the available links for PAH in the Map Viewer table, the link â€Å"sv† led to a page with the title â€Å"Homo sapiens chromosome 12 genomic contig, GRCh37 reference primary assembly.† Searching for the gene gives the following (zoomed-in and cropped) structure:   Figure 3 Structure of PAH gene (11) Though not obvious from the first glance, later we will see that the bottom sequence actually represents the structure of the PAH, with the vertical green lines representing the 13 exons. After further searching, the following (rotated) PAH structure showing the 13 exons and 12 introns can be found in the Map Viewer under â€Å"ensRNA†:   Figure 4 Another illustration of the structure of PAH gene (11) Finding those, however, takes previous explicit knowledge and some work to track down the specific illustrations. In contrast, finding the number of exons and introns and an illustration of the structure of the PAH gene in the Ensembl website was very straightforward. The following illustration can be found in the same page as Figure 1: Figure 5 Ensembl illustration of PAH gene structure This strand, one of the transcripts available in the Ensembl page, clearly shows the 13 exons in a DNA sequence. Comparing this structure to Figures 3 and 4, the numbers and the arrangements of the exons and introns are exactly the same. However, relative to all the tedious searching needed to find the same answers in the NCBI website, the information needed for the question was instantly available from the Ensembl site, and the interface was very easy to understand. Common PAH mutations: Mutations in general can refer to abnormalities in function or structure of the concerned enzyme in the gene phenotype. As previously discussed, however, such as the causes of PKU and HPA, the human PAH gene has displayed allelic differences and pathogenic transformations throughout its structure. The common types of mutations and their occurrence according to a previous study are: missense mutations with 62% of the alleles, small or large deletions with 13%, splicing defects with 11%, silent polymorphisms with 6%, nonsense mutations with 5%, and insertions with 2% of the PAH alleles. (6) Table1 PAH mutation statistics Mutation Type: # of Mutation(s) Missense 336 Deletion 73 Splice 62 Silent 32 Nonsense 28 Insertion 10 Sil./Splice 3 Unknown 3 Total mutations: 547 Most reported Mutation (Association): p.R408W (214) Missense, as can be seen above, is the most common cause of mutation in the PAH gene, the molecular mechanism of this is the improper folding of the protein structure, causing aggregation or degradation. As mentioned earlier, the mutations of PAH are commonly caused by single changes in the amino acid. One of the missense mutations, for example, occurs in E1 nucleotide 1 with the change of ATG to GTG. However, there is also missense mutation in region E3 with sequence 187.000 in nucleotide 187; this is called ACC/CCC;CAC/AAC. The second most common type of mutation is deletion. An example of deletion mutation is in regions E2-12 with sequence 168.001 in nucleotide 168. This is called GAG/GAA;G/A and has been noted to have occurred in Palestinians Arabs. (2, 3, 12)   Other examples can be seen in Appendix (I). As mentioned earlier, there are three common variations of PKU: classical PKU, MHP, and non-PKU HPA. These variations which are basically different degrees of severity of the disorder are caused by the different kinds of mutations that cause varying PAH activity as well as allelic variations. The latter effect at the locus of the gene determines the metabolic phenotype of the enzyme deficiency. In general, however, the mutations in the PAH gene are localized in a main part of the gene instead of being randomly distributed, as they occur either within or without the active site. What is interesting to note is that the PAH gene in intron 12 involves the single base change of guanine to adenine in the canonical 5-prime splice donor site where the first identified PKU mutation occurred. (3) Two out of the 6 links given by the Gene Gateway page were no longer working, one was solely dedicated to SNP, one was a link to a database that had links to other databases, and the last two were already explored thoroughly in previous parts of this assignment. The data presented in this section were mostly from the entire site dedicated to PAH gene mutations, the Phenylalanine Hydoxylase Locus Knowledgebase (5). This site, also a database, was arrived at after searching through the Locus Specific Mutation Databases which in turn arrived at from Human Genome Variation Society: Variation Databases and Related Sites. While the OMIM site did give some details about previous studies related to PAH gene mutations, they were more of a history of the mutations and examples of the studies. Finding the needed information was difficult because one needed to go through link after link and website after website, sometimes even arriving at the same website numerous times through different pathwa ys and still not obtaining any results. The PAHdb was by far, the only site that showed any data regarding the common mutations. Single nucleotide polymorphisms (SNPs) of the PAH gene: To date, 1220 SNPs for the PAH gene have been discovered, although GeneCards (2) states only 1097 from the NCBI website. In general, the SNPs involve the changing of a single base, as shown in Appendices I and II. Examples are the three found on exon 3, each of which has a single change of base, name cytocine, thiamine, and adeninine(13). Examples of these PAH gene SNPs are the rs63749677, rs63749676, rs63581460 and rs63499960; some of these are tabulated in Appendix (II). These SNPs are not randomly distributed as out of the 13 exons, they are seen in exons 1-7 and 12. Searching the NCBI website, however, resulted in 55 entries of SNPs with the following format: rs79931499 [Homo sapiens] CAATCCTTTGGGTGTATGGGTCGTAG[C/G]GAACTGAGAAGGGCCGAGGTATTGT 12 The above entry, an example of the results from the query in the NCBI SNP website, shows essential information about the SNP as well as options one can view. Compared to the other related links, which did not yield any useful information other than linking back to this site, the NCBI site dedicated purely to SNPs was simple and the information was easy to retrieve. Due to the very large number of SNPs, however, it would be difficult to evaluate all of them. Designing PCR primers: The given instructions and the program given in the website were rather straightforward, so the designing of the primer was the easiest part of the activity. The mRNA sequence was easily downloadable and the program was user-friendly (14). Being able to design primers this way was very fast and easy. The resulting primers are in Appendix (III). References: 1. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/omim/612349 2. Hoeks M, den Heijer M, Janssen M. Adult issues in phenylketonuria. The Netherlands journal of medicine2009;67(1):2. 3. [21/09/09]; Available from: http://www.ensembl.org/index.html. 4. [26/08/10]; Available from: http://www.genecards.org/cgi-bin/carddisp.pl?gene=PAHsearch=pah#loc 5. [26/08/10]; Available from: http://www.pahdb.mcgill.ca. 6. Carter K, Byck S, Waters P, Richards B, Nowacki P, Laframboise R, et al. Mutation at the phenylalanine hydroxylase gene (PAH) and its use to document population genetic variation: the Quebec experience. European Journal of Human Genetics1998;6(1):61-70. 7.   [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gndpart=phenylketonuria 8. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=genepart=pku 9. [26/08/10]; Available from: http://www.ensembl.org/Homo_sapiens/Location/View?db=core;g=ENSG00000171759;r=12:103232104-103311381;t=ENST00000307000 10. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/projects/mapview/maps.cgi?taxid=9606chr=12MAPS=pheno,morbid,genec,decode,ensrna,ensgenes,rnaRn,rnaMm,rnaHs,rnaGga,rnaBt,gbdna,rna,ugHs,genes-rcmd=focusfill=80query=uid(136508683,136446655,12845117,12579049,8990832,717234,698472,11088097,11049717,6481463,570698,568170,34586070,16320694,13572526,34590012,128619463,415205)QSTR=pah 11. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/projects/sviewer/?id=NT_029419.12v=65375409..65454686 12. *Robin A Williams, 2 Cyril DS Mamotte,2 *John R Burnett1,3. Phenylketonuria: An Inborn Error of Phenylalanine Metabolism 13.  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚      [updated 21/09/09]; Available from: http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=5053 14.  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚      [21/09/09]; Available from: http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi Appendices: Appendix (I) Examples 1. Systematic Name: c.1AG Region: E1 Reference (1st): Mutation Name: p.M1V Sequence: 0.000 JOHN SW, ROZEN R, LAFRAMBOISE R, LABERGE C, SCRIVER CR: Novel PKU mutation on haplotype 2 in French-Canadians. Am J Hum Genet 45:905-909, 1989 Other Name: ATG/GTG Length: 1 Nucleotide No.: 1 Rest. Site: -Xba I Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 2. Systematic Name: c.3GA Region: E1 EIKEN HG, KNAPPSKOG PM, APOLD J, SKJELKVÃ…LE L, BOMAN H: A de novo phenylketonuria mutation: ATG (Met) to ATA (Ile) in the start codon of the phenylalanine hydroxylase gene. Hum Mut 1:388-391, 1992 Mutation Name: p.M1I Sequence: 3.000 Other Name: ATG/ATA Length: 1 Nucleotide No.: 3 Rest. Site: -NspI Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 3. Systematic Name: c.117CG Region: E2 FORREST SM, DAHL HH, HOWELLS DW, DIANZANI I, COTTON RGH: Mutation detection in phenylketonuria by using chemical cleavage of mismatch: Importance of using probes from both normal and patient samples. Am J Hum Genet 49:175-183, 1991 Mutation Name: p.F39L Sequence: 117.000 Other Name: TTC/TTG Length: 1 Nucleotide No.: 117 Rest. Site: -MboII, +MaeIII Mutation Type: Missense Syst. Name gDNA: Erlandsen H, Pey AL, Gà ¡mez A, Pà ©rez B, Desviat LR, Aguado C, Koch R, Surendran S, Tyring S, Matalon R, Scriver CR, Ugarte M, Martà ­nez A, Stevens RC.: Correction of kinetic and stability defects by tetrahydrobiopterin in phenylketonuria patients with certain phenylalanine hydroxylase mutations. Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No Appendix (II) SNPs of the PAH gene Region Contig position mRNA pos dbSNP rs# cluster id Hetero- zygosity Function dbSNP allele Protein residue Codon pos Amino acid pos exon_12 26716405 1750 rs59326968 N.D. synonymous C Asn [N] 3 426 contig reference T Asn [N] 3 426 exon_7 26728783 1314 rs5030851 N.D. missense T Leu [L] 2 281 contig reference C Pro [P] 2 281 exon_6 26731200 1061 rs5030653 N.D. missense (22bp) [CIKPMLAN] 1 197 frame shift -/TGTATAAAACCCATGCTTGCTA 1 197 contig reference (22bp) [LYKTHACY] 1 197 26731262 1020 rs17852373 N.D. missense G Gly [G] 2 183 contig reference A Glu [E] 2 183 exon_3 26770856 671 rs5030842 N.D. missense C Pro [P] 1 67 contig reference T Ser [S] 1 67 contig reference A Ser [S] 3 36 exon_1 26793098 474 start codon 1 Appendix (III) Designed Primers Exon1 ENSE00001141448 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG PCR primer design: No mispriming library specified Using 1-based sequence positions OLIGO  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚     seq LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  369  Ã‚   20  Ã‚   59.83  Ã‚   55.00   6.00   2.00   Ã‚  TCCTCCCTAGTGCGAGGTTA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚     522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   3.00   2.00   Ã‚  CAGAGAGTTTCCTGCCCAAG SEQUENCE SIZE: 533 INCLUDED REGION SIZE: 533 PRODUCT SIZE: 154, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 3.00 1 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT 61 TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC 121 TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG 181 CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG 241 CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA 301 CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA 361 CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC 421 TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA 481 CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  Ã‚  Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     seq 1 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  339  Ã‚   20  Ã‚   59.77  Ã‚   50.00   Ã‚  3.00   Ã‚  1.00  Ã‚  Ã‚     ACGCAAGAGACACCCTTTGT RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   Ã‚  3.00   Ã‚  2.00   Ã‚  Ã‚  Ã‚  Ã‚  CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 184, PAIR ANY COMPL: 6.00, PAIR 3 COMPL: 2.00 2 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   318  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   2.00 GTTACTGTGCGGAGATGCAC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   3.00   2.00 CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 205, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 3 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   157  Ã‚   20  Ã‚   60.07  Ã‚   55.00   2.00   0.00 CTGGCTTCTTCCCTTTACCC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   337  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 181, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   156  Ã‚   20  Ã‚   60.07  Ã‚   55.00   3.00   0.00 CCTGGCTTCTTCCCTTTACC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   337  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 182, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 Statistics con  Ã‚   too  Ã‚  Ã‚   in  Ã‚  Ã‚   in  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   no  Ã‚  Ã‚   tm  Ã‚  Ã‚   tm   high   high  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   high sid   many  Ã‚   tar   excl  Ã‚   bad  Ã‚  Ã‚   GC  Ã‚   too  Ã‚   too  Ã‚   any  Ã‚  Ã‚   3   poly  Ã‚   end ered  Ã‚  Ã‚   Ns  Ã‚   get  Ã‚   reg  Ã‚   GC% clamp  Ã‚   low   high compl compl  Ã‚  Ã‚  Ã‚   X   stab  Ã‚  Ã‚   ok Left  Ã‚  Ã‚   3637  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   162  Ã‚  Ã‚  Ã‚   0  Ã‚   419   2558  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   2  Ã‚  Ã‚   22  Ã‚  Ã‚   73  Ã‚   401 Right  Ã‚   3701  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   130  Ã‚  Ã‚  Ã‚   0  Ã‚   321   2817  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   2  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   78  Ã‚   353 Pair Stats: considered 140, unacceptable product size 129, high end compl 3, ok 8 primer3 release 1.1.4 KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     seq 1 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00   Ã‚  Ã‚  Ã‚  GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   265  Ã‚   20  Ã‚   58.12  Ã‚   40.00   3.00   0.00   Ã‚  TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 247, PAIR ANY COMPL: 2.00, PAIR 3 COMPL: 0.00 2 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00  Ã‚     GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   260  Ã‚   22  Ã‚   60.05  Ã‚   40.91   4.00   0.00   Ã‚  GATGACCCCAAAAGATTTACCA PRODUCT SIZE: 242, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 3 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   45  Ã‚   20  Ã‚   60.39  Ã‚   50.00   6.00   1.00  Ã‚     AGCCATGGACAGAATGTGGT RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   265  Ã‚   20  Ã‚   58.12  Ã‚   40.00   3.00   0.00   Ã‚  TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 221, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00   Ã‚  Ã‚  Ã‚  GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   258  Ã‚   20  Ã‚   57.92  Ã‚   40.00   4.00   0.00   Ã‚  TGACCCCAAAAGATTTACCA PRODUCT SIZE: 240, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 Statistics con  Ã‚   too  Ã‚  Ã‚   in  Ã‚  Ã‚   in  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   no  Ã‚  Ã‚   tm  Ã‚  Ã‚   tm   high   high  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   high sid   many  Ã‚   tar   excl  Ã‚   bad  Ã‚  Ã‚   GC  Ã‚   too  Ã‚   too  Ã‚   any  Ã‚  Ã‚   3   poly  Ã‚   end ered  Ã‚  Ã‚   Ns  Ã‚   get  Ã‚   reg  Ã‚   GC% clamp  Ã‚   low   high compl compl  Ã‚  Ã‚  Ã‚   X   stab  Ã‚  Ã‚   ok Left     Ã‚  7708  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   791  Ã‚  Ã‚  Ã‚   0   4562  Ã‚   600  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   14  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   52   1689 Right  Ã‚   7734  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0   1269  Ã‚  Ã‚  Ã‚   0   4609  Ã‚   311  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   6  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   44   1495 Pair Stats: considered 2222, unacceptable product size 2195, high end compl 6, ok 21 primer3 release 1.1.4

Lila 4 ever essays

Lila 4 ever essays Im going to talk about a film that I find really fascinating, a film called Lila 4 Ever. Lila 4 ever is a film about a 16 year old girl called Lila who is living in poor suburb somewhere in the former Soviet Union. She dreams about a better life. The film opens as Lila is packs her suitcase and waits for her mother and her new boyfriend to come and pick her up They are moving to Unites States. When mother and her boyfriend arrive, they tell her that she cant come with them now and Lila is promised to be able to join them very soon. Mum tells her that she is going to receive a latter soon with money for the ticked, but as no letter from her mother arrives, Lila realizes that shes been abandoned. She is left with her cruel aunt who kicks her out from apartment and forced to move into an old small dilapidated flat with no electricity or heating. She hangs out with some losers who also try to escape this unbearable world by sniffing glue and taking pills. Her only true friend is the 11-year-old boy Moldova who is with Lila the whole time. His he doesnt want to go home because his father is very violent so Moldova crashes in her apartment. He has falling in love with Britney Spears, but also falls in love with Lila too. He also dreams to play basketball professionally. Together Lila and Moldova travel around the area and fantasize about how one could make life easier to live. One day as the two of them are sitting on a bench Lila decides to scratches her name on a bench so it never disappears. As she cant find a job she is forced to prostitutes herself. After a firs paycheck she buys a basketball to her friend Voladja, because he had never had a basketball before. When he played by himself he threw a soda can instead of a ball. Well after a while Lila finds out that she cant bear sleeping with strangers so she stops. So in many ways she tries to coupe with a situa...

Data Results and Discussion Essay Example | Topics and Well Written Essays - 2000 words

Data Results and Discussion - Essay Example Aside from the net cash receipts from the sale of tickets, there are the peripheral gains that should be attained in commercial activity of Olympic tourists, and the spending by both participants and spectators that were to spur local businesses. After the Olympics, further gains are to be had by the benefits of urban regeneration, which is the choice and development of depressed urban areas, making them the site, close to the site, of the Olympic infrastructure, so that after the Games, the newly developed property could be productively used either as new residential housing or new sites for commercial activity, thereby spurring growth. The Gross Domestic Product (GDP) is comprised of household consumption, government spending, investment and net trade (exports less imports). Of all the components of GDP, household consumption is the largest which typically comprises 60% of the economy. Government usually takes up 23%, and investment 15%. The fourth quarter in 2012, the consumption rose by 0.2% in real terms compared to the third quarter 2012. According to the government Economic Outlook, this rate of growth has been the slowest for consumption since the fourth quarter 2011. The graph shows, however, that there is a spike in government consumption for the fourth quarter 2012, which amounts to a 0.6% rise over the previous quarter. During the same time, exports receded by 1.5%, as did imports by 1.2%. The next graph depicts the fluctuation in gross fixed capital formation (GFCF). This refers to the investment in buildings and machinery. The fourth quarter in 2012 saw GFCF fell by 0.4%, which is 1.7% higher than the preceding year. For the same quarter, business investment decreased by 1.2%, which is significant because this indicator (business investment) is a significant component of GFCF. The fact that the rate of decrease in business investment is three times the rate of decrease of GFCF means that capital formation

To what extent was the Irish famine responsible for the decline of the Essay

To what extent was the Irish famine responsible for the decline of the Irish language - Essay Example As seen below, this famine resulted in the decline of the language in several ways including the death of its speakers, emigration to other parts of the world and the introduction of British culture to Ireland. How famine accelerated it When the Irish famine hit Ireland, the main crop to be affected was the potato hence it’s sometimes referred to as the Irish potato famine. The famine had a huge death toll that resulted in the death of 1 to 1.5 million people which although not much when compared to death rates in places such as china (13 million) when they had their own famine, was a lot when compared to the ratio of the general population. The population of Ireland was only 8 million when the famine started and by the time it ended population census results showed that the population had declined to around 6.5 million people. This meant that the population had declined by 18 % signifying a huge loss of native speaking Irish people.1 Moreover, since the hardest hit areas were those that still maintained speaking the Irish language. The Irish famine also resulted in the mass immigration of many Irish people to other parts of Europe as they escaped the hunger and strict anti-Catholic policies the British government had put in place. The migration resulted in many of them moving to America where they searched for new opportunities for employment however they were not welcomed due to the contempt given to the Irish culture. It is estimated that at least a million people migrated from Ireland to USA Newfoundland and Britain, resulting a significant drop in the population. People from Ireland were often stereotyped as aggressive and violent and it was not uncommon for job advertisements to specifically state that they did not want people from Ireland. For a person from Ireland to therefore survive or succeed they would have to lose their Irish accent and be Americanised. This therefore resulted in a population which although sharing a common Irish heritage, d id not speak the Irish language and thus a decline in it.2 One of the factors that caused the famine and even made it worse was the marginalization of the Irish-catholic community by the British government. The British government that had been ruling Ireland since 1801 and had put in place discriminatory policies against the Irish Catholic that barred them from voting and the right to owning land.3 Many Irish viewed these policies as a form of colonization but it was clear that for an individual to climb up the social ladder they would have to adopt the British culture and religion and thus neglect their own heritage. The British policies have in fact been identified as one of the reasons the famine ravaged with such intensity as even though people were starving, food crops was still being exported from Ireland, the tenant system of farming had also meant that Irish workers could not practice large scale agriculture that had grown in popularity with the agrarian revolution. The only crop that was able to grow and support a family on the small farms were potatoes. While some might have being willing to make due with meagre earnings as a punishment for their cultural identity, when the famine reached its climax many faced with the option of death or assimilation into British culture chose to align themselves with the British way of life so as to have access to more social amenities, rights and employment opportunities as English was the language spoken by the landlords and merchants.4

Reaction Writing # 2 Essay Example | Topics and Well Written Essays - 250 words

Reaction Writing # 2 - Essay Example In 2001, SEC started investigating Enron’s accounting practices. In this case charges were as manipulating the accounting rules and the masking of enormous liabilities and losses. The CEO, CFO and other key leaders were charged bank fraud, conspiracy, money laundering and insider trading. The downfall of Enron and its leaders imprisoned is one of the most reported ethical violations. Ethical violations yielded to the company’s insolvency as well as destroyed a very large audit firm called Arthur Andersen (Forbes, 2013). If I was a manager, be it a top or middle position, I would make sure that I have influenced all those below me to be ethical regardless of the unethical practices carried out by top managers. This is because every organization needs a top management that is ethical in accordance with the company’s ethical approaches. The top management in turn influences the middle management who in turn influences the other employees. The shareholders have always expected the executive management to be ethical but it is not always the case. Therefore, if I mange to influence all the employees to be ethical, it would be very easy to bring to justice all the violators and avoid leading the company to

A Pro Drop Parameter English Language Essay

A Pro Drop Parameter English Language Essay Pro-drop parameter is such a parameter for whether the declarative sentence in universal grammar can omit the subject. It is also known as null subject parameter, non-subject parameter. The so-called pro-drop phenomenon refers to the subject can be deleted in the declarative sentence (White, 1986). The pro-drop parameter (null subject parameter) proposed is based on the phenomenon of omitted subject pronouns in some language. The empty synonymous is commonly known as pro, the language of the subject can be omitted due to the pro appears only in subject position, or the language with no main statement can be called as pro-drop language. Whether the subject can be omitted constitutes a parameter in universal grammar, known as pro-drop parameter. Pro-drop parameter is a universal grammar parameter which is the most discussed (Chomsky and Lasnik, 1991). It is an important parameter to examine the second language acquisition effect in the study of the second language learning. Pro-drop parameter assumption studies the adult null subject phenomenon to show the object-drop in the childrens language, the basic premise of the theory is for the most grammar provides null subject parameter for language learners (White, 1986). This default parameter allows null subject, so only when the childs language environment provides them with clear evidence to prove their language cannot be null subject, it will lead them to reset the parameters. Different languages à ¢Ã¢â€š ¬Ã¢â‚¬ ¹Ãƒ ¢Ã¢â€š ¬Ã¢â‚¬ ¹have different pro-drop parameter values, that is, to determine whether the declarative sentence can omit the subject. Chomsky (2000) argues that the sentence has two levels, one is the deep structure (d-structure) to express the sentence vocabulary meaning, it is the concept structure in the brain before the people to talk; the other is the shallow structure (s -structure) to express the moving relationship of sentence elements, it is the sound people speak. Principles and parameters theory claims that empty synonymous pro only appears in d-structure, and does not appear in s-structure (Ouhalla, 2000). In the d-structure of the implied subject sentence, the subject is existed, invisible pro is taken as the subject, the main word syntactic component does not disappear, and it is still present in the speechs heart and brain syntax with psychological reality. In the s-structure of the implied subject, the subject is existed in the form of null, the subject form of this null is called pro. It knows that the pro is implied in s-structure. Although many studies have tried to explain second language learners like children acquisition native-like to set the open parameters, since the early 1980s, people found that the initial stage of the second language learners will transfer the parameters set in mother tongue (Gass and Schachter, 1989; Lydia, 1989, 1991). Here, taking the implied pro parameters for illustration here carries out a brief description of the similarities and differences in setting of this parameter in the native language. In addition, it will also explain the potential advantages are of the assumption there is a pro drop parameter. In childrens brain, the setting of the language parameter can be considered a switch: children adjust each parameter value according to their heard language material. Chomsky (2000) suggests that the transition from the initial state to a stable state is actually the process of setting switch direction (Cook and Newson, 2000, pp.110). Acquisition of English syntax means setting the all parameters in universal grammar according to the English habit, and the parameter settings are activated relying on linguistic evidence. Usually there are three linguistic à ¢Ã¢â€š ¬Ã¢â‚¬ ¹Ãƒ ¢Ã¢â€š ¬Ã¢â‚¬ ¹instances: positive evidence, direct negative evidence and indirect negative evidence. Positive evidence refers to the language heard by children. The linguistic instance heard by British children enables them to find English is a non-implicit pro parameter language. Spanish children will find that Spanish is the implicit pro parameter language. Direct negative evidence, also known as direct correc tion, is directly from the adult corrections. However, the direct correction is limited. Even if corrected directly, children also tend to ignore, thus the direct correction cannot be the main source for the children to obtain the language skills. Indirect negative evidence is such a language form for the children cannot hear. British children are impossible to hear such as Sits. statement, or reversed predicate word order, such as Sits he. So, some studies suggest that the indirect negative instance contributes to the setting of parameters. Hyams (1981) specifically studied the implicit pro parameter setting in the native language acquisition. She found that the British children could speak many sentences without subject like the Spanish, such as: Play it. Or No go in. At the same time, in their language they will leave the words such as it and there. Gradually, they began to understand that the English needs the lexical subject and added the function words it and there in sentence s. While the Spanish children in the beginning thought that Spanish is the language of the implicit parameter, and does not need to change. Hyams (1981) believes that in the acquisition of the mother tongue, the children regard the implied pro parameters as a default, it is, regardless of their language, always speak the sentences without subject, the children eventually found the parameter values à ¢Ã¢â€š ¬Ã¢â‚¬ ¹Ãƒ ¢Ã¢â€š ¬Ã¢â‚¬ ¹from the positive evidence. Non-implied pro parameters language English uses impersonal Indefinite pronoun it in the sentences expressing weather: Its raining. In the presence of the sentence, there is used: Once upon a time, there were three bears. The emergence of expletive subject makes the British children were aware of the English is a non-implied subject language. Cook (2000: 90) argued that the basis for the universal grammar to explain language acquisition lies in the positive evidence plays a key role. Children are mainly from the positive evide nce rather than negative evidence to acquisition of the mother tongue. According to the universal grammar, the mother tongue acquisition process is language input principles and parameters native language syntax, and then whether the process of second language acquisition is the second language input principles and parameters second language syntax? It is found that: 1) the second language learners language knowledge is not enough, and the vast majority of people cannot achieve the equivalent level of mother tongue; 2) for children, the difficulty of acquisition of any language is the same, as long as language input, any language can perfectly be of acquisition. For second language learning, the situation is not the case, such as the native English people is much easier learning French than learning Chinese; 3) the development of the second language tends to occur fossilization phenomenon at some stage; 4) the second language learners ultimately achieve different levels of the language, their learning methods are also different (Towell and Hawkins, 1994). Therefore, we have reason to believe that second language learners indirectly used the universal grammar through the knowledge of the mother tongue. They took the parameter field of their native language as a starting point, gradually shifted the parameter field of the second language, and the essence is transfer. People conducted a large number of researches on the mother tongue as the second language acquisition of the implied subject or non-implied subject. The purpose for the study by White (1986) is to investigate whether the foreign students are influenced by the mother tongue parameter values in setting of the non-implied pro parameter values of English. The objects of study include two sets of intermediate English level of students: one group is 37 French students, and the other group is 32 Spanish students and 2 Italian students. French and English are the language of non-implied pro parameter, that is, to select a negative value in the subject parameter omitted, while the Spanish and Italian select a positive value. The two groups of subjects receive the test of English grammar judgment and conversion questions. The results showed that the Spanish and Italian students are easy to mistakenly accept the English sentences which omitted the subject. French students are rare to wrongly accept the English sentences which omitted the subject. Phinney (1987) carried out the bidirectional test to study the parameter settings. The subjects include the Spanish students learning English and the British students learning Spanish. By analyzing the composition of their foreign language, Phinney draw two important results: first the British students learning Spanish can correctly use the Spanish sentences which omitted the subject, and will not be wrongly used the filled subject; Second, the Spanish students learning English can easy to wrongly use the omitted subject pronoun in clause and the filled subject in English. The objects of the study by Liceras (1989) are the students learning Spanish, including 2 French students and 32 British students. She found that even primary level of Spanish students correctly judged incorrectly filled subject of Spanish sentences, and can understand Spanish can omit the subject. While the students with advanced Spanish level performed even better. We can draw from the above empirical studies that the pro-drop parameter settings in foreign language acquisition are summarized as follows: 1) When the implicit pro parameter values of mother tongue and foreign language à ¢Ã¢â€š ¬Ã¢â‚¬ ¹Ãƒ ¢Ã¢â€š ¬Ã¢â‚¬ ¹are the same, the mother tongue can facilitate the acquisition of foreign language. English and French must not omit the subject, the French students in acquisition of English are rarely false acceptance subject of English sentences, native parameter values à ¢Ã¢â€š ¬Ã¢â‚¬ ¹Ãƒ ¢Ã¢â€š ¬Ã¢â‚¬ ¹take place the positive transfer; 2) A non-native language is non-implicit pro parameter language, that is, the selected parameter value is negative, while the foreign language is an implicit pro parameter language, that is, the selected parameter value is positive, the mother tongue parameter values à ¢Ã¢â€š ¬Ã¢â‚¬ ¹Ãƒ ¢Ã¢â€š ¬Ã¢â‚¬ ¹will be negative transfer to the foreign language learning, but the effect is temporary, and the re-setting of the parameter values is not very difficult; 3) The mother tongue selected the positive value of subject omitted parameter, and the foreign language selected the negative value of subject parameter; the mother tongue will produce more lasting negative impact on foreign language learning, while the foreign language learning is prone to be rigid. However, it should be noted that studying from the view of the theory of universal grammar is bound to focus on access to knowledge in grammar, in particular the acquisition of knowledge of the syntactic structure. The limitations of the universal grammar theory prevent people to examine the language use level. This is because, according to Chomskys (2000) views, language behavior is the actual use of these rules by a person listens to or speaks, that is also called as the language ability and performance. Language behavior is just an indirect and incomplete reflection on the language skills, which is often influenced by many factors and does not reflect the true language ability, it is hard to be through language skills or language behavior performance to understand the language ability, the study of language should point directly to the language ability of dominant language behavior (Yip, 1989). Therefore, the scope of pro-drop parameter assumption is only limited to the acquisitio n of language structure, namely the establishment of parameters, which shows a very micro level, many of the indicators associated with the second language learning are unable to insight. In addition, linguists Fillmore (1991) argued that universal grammar and general cognitive mechanisms are associated with second language acquisition. In the acquisition process of second language, the role of universal grammar cannot be ignored, but the second language learning is different from the native language acquisition. With young children grew older, general cognitive ability and strategy increasingly play a more important role compared to UG. From psychology, especially psycholinguistic perspective to explore childrens second language learning may well be another important avenue of research. Thus, the single perspective of study makes people get the above conclusions, multi-angle and multi-channel study will receive more comprehensive and objective conclusions and will get more in-depth, substantive understanding of English education mode.

Harvey Keitel: The Art Of Darkness :: essays research papers

Harvey Keitel: The Art of Darkness   Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚  Harvey Keitel was born in Brooklyn, New York, on May 13, 1939. Harvey was the youngest of 3 children, one brother and one sister. Harvey’s childhood was rough. He spent most of his times on the streets of New York. He was raised in a rather bad neighborhood, and he began to hang out with a local gang. Although things were bad, every summer he would go to Coney Island, climb rocks, and fish. He was a normal child raised in a very dangerous place, but he knew what was the right thing and what was the wrong thing to do. Although he was in a gang, he never really got himself into much trouble.   Ã‚  Ã‚  Ã‚  Ã‚  At the age of 16, Harvey Keitel did not know what to do with his life, so he decided to enlist in the Marines. Harvey was stationed in Lebanon, and stayed there for his 3 year term. When Harvey got out of the Marines in 1959, he was still unsure of what he wanted to do for a living. For the time being, he began a job as a shoe salesman. About a year later from selling shoes, Harvey began to take an interest in becoming an actor. He began to try out for part in off Broadway plays. Stella Adler and Strasberg found promise in Harvey Keitel, and they began to teach him ways to become a better actor. Even under these two stars wings, finding work was still very hard for Harvey. He did find some job opportunities in very off Broadway plays. While Harvey Keitel was a very good actor, it did not look like he was going to be going anywhere with acting.   Ã‚  Ã‚  Ã‚  Ã‚  Harvey Keitel was about to give up on acting altogether, but he decided to give it a second chance when he answered a newspaper ad by Martin Scorsese, who at the time, was a NYU student looking for actors for his thesis work, Who’s That Knocking On My Door?. When Harvey and Martin met, they became fast friends, and have stayed friends since than. Keitel has worked with Scorsese many times since than, and only Robert De Niro has worked with Scorsese more than Keitel.   Ã‚  Ã‚  Ã‚  Ã‚  Things were looking good for Harvey Keitel, but his career took a downfall when he was passed over for a role in Francis Ford Coppola’s Apocalypse Now.